diff options
Diffstat (limited to 'Tools/stringbench/stringbench.py')
| -rw-r--r-- | Tools/stringbench/stringbench.py | 1482 |
1 files changed, 0 insertions, 1482 deletions
diff --git a/Tools/stringbench/stringbench.py b/Tools/stringbench/stringbench.py deleted file mode 100644 index 5abc25a..0000000 --- a/Tools/stringbench/stringbench.py +++ /dev/null @@ -1,1482 +0,0 @@ - -# Various microbenchmarks comparing unicode and byte string performance -# Please keep this file both 2.x and 3.x compatible! - -import timeit -import itertools -import operator -import re -import sys -import datetime -import optparse - -VERSION = '2.0' - -def p(*args): - sys.stdout.write(' '.join(str(s) for s in args) + '\n') - -if sys.version_info >= (3,): - BYTES = bytes_from_str = lambda x: x.encode('ascii') - UNICODE = unicode_from_str = lambda x: x -else: - BYTES = bytes_from_str = lambda x: x - UNICODE = unicode_from_str = lambda x: x.decode('ascii') - -class UnsupportedType(TypeError): - pass - - -p('stringbench v%s' % VERSION) -p(sys.version) -p(datetime.datetime.now()) - -REPEAT = 1 -REPEAT = 3 -#REPEAT = 7 - -if __name__ != "__main__": - raise SystemExit("Must run as main program") - -parser = optparse.OptionParser() -parser.add_option("-R", "--skip-re", dest="skip_re", - action="store_true", - help="skip regular expression tests") -parser.add_option("-8", "--8-bit", dest="bytes_only", - action="store_true", - help="only do 8-bit string benchmarks") -parser.add_option("-u", "--unicode", dest="unicode_only", - action="store_true", - help="only do Unicode string benchmarks") - - -_RANGE_1000 = list(range(1000)) -_RANGE_100 = list(range(100)) -_RANGE_10 = list(range(10)) - -dups = {} -def bench(s, group, repeat_count): - def blah(f): - if f.__name__ in dups: - raise AssertionError("Multiple functions with same name: %r" % - (f.__name__,)) - dups[f.__name__] = 1 - f.comment = s - f.is_bench = True - f.group = group - f.repeat_count = repeat_count - return f - return blah - -def uses_re(f): - f.uses_re = True - -####### 'in' comparisons - -@bench('"A" in "A"*1000', "early match, single character", 1000) -def in_test_quick_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("A") - for x in _RANGE_1000: - s2 in s1 - -@bench('"B" in "A"*1000', "no match, single character", 1000) -def in_test_no_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("B") - for x in _RANGE_1000: - s2 in s1 - - -@bench('"AB" in "AB"*1000', "early match, two characters", 1000) -def in_test_quick_match_two_characters(STR): - s1 = STR("AB" * 1000) - s2 = STR("AB") - for x in _RANGE_1000: - s2 in s1 - -@bench('"BC" in "AB"*1000', "no match, two characters", 1000) -def in_test_no_match_two_character(STR): - s1 = STR("AB" * 1000) - s2 = STR("BC") - for x in _RANGE_1000: - s2 in s1 - -@bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000) -def in_test_slow_match_two_characters(STR): - s1 = STR("AB" * 300+"C") - s2 = STR("BC") - for x in _RANGE_1000: - s2 in s1 - -@bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")', - "late match, 100 characters", 100) -def in_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = (m+d)*300 + m+e - s2 = m+e - for x in _RANGE_100: - s2 in s1 - -# Try with regex -@uses_re -@bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")', - "late match, 100 characters", 100) -def re_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = (m+d)*300 + m+e - s2 = m+e - pat = re.compile(s2) - search = pat.search - for x in _RANGE_100: - search(s1) - - -#### same tests as 'in' but use 'find' - -@bench('("A"*1000).find("A")', "early match, single character", 1000) -def find_test_quick_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("A") - s1_find = s1.find - for x in _RANGE_1000: - s1_find(s2) - -@bench('("A"*1000).find("B")', "no match, single character", 1000) -def find_test_no_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("B") - s1_find = s1.find - for x in _RANGE_1000: - s1_find(s2) - - -@bench('("AB"*1000).find("AB")', "early match, two characters", 1000) -def find_test_quick_match_two_characters(STR): - s1 = STR("AB" * 1000) - s2 = STR("AB") - s1_find = s1.find - for x in _RANGE_1000: - s1_find(s2) - -@bench('("AB"*1000).find("BC")', "no match, two characters", 1000) -def find_test_no_match_two_character(STR): - s1 = STR("AB" * 1000) - s2 = STR("BC") - s1_find = s1.find - for x in _RANGE_1000: - s1_find(s2) - -@bench('("AB"*1000).find("CA")', "no match, two characters", 1000) -def find_test_no_match_two_character_bis(STR): - s1 = STR("AB" * 1000) - s2 = STR("CA") - s1_find = s1.find - for x in _RANGE_1000: - s1_find(s2) - -@bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000) -def find_test_slow_match_two_characters(STR): - s1 = STR("AB" * 300+"C") - s2 = STR("BC") - s1_find = s1.find - for x in _RANGE_1000: - s1_find(s2) - -@bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000) -def find_test_slow_match_two_characters_bis(STR): - s1 = STR("AB" * 300+"CA") - s2 = STR("CA") - s1_find = s1.find - for x in _RANGE_1000: - s1_find(s2) - -@bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")', - "late match, 100 characters", 100) -def find_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = (m+d)*500 + m+e - s2 = m+e - s1_find = s1.find - for x in _RANGE_100: - s1_find(s2) - -@bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)', - "late match, 100 characters", 100) -def find_test_slow_match_100_characters_bis(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = (m+d)*500 + e+m - s2 = e+m - s1_find = s1.find - for x in _RANGE_100: - s1_find(s2) - - -#### Same tests for 'rfind' - -@bench('("A"*1000).rfind("A")', "early match, single character", 1000) -def rfind_test_quick_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("A") - s1_rfind = s1.rfind - for x in _RANGE_1000: - s1_rfind(s2) - -@bench('("A"*1000).rfind("B")', "no match, single character", 1000) -def rfind_test_no_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("B") - s1_rfind = s1.rfind - for x in _RANGE_1000: - s1_rfind(s2) - - -@bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000) -def rfind_test_quick_match_two_characters(STR): - s1 = STR("AB" * 1000) - s2 = STR("AB") - s1_rfind = s1.rfind - for x in _RANGE_1000: - s1_rfind(s2) - -@bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000) -def rfind_test_no_match_two_character(STR): - s1 = STR("AB" * 1000) - s2 = STR("BC") - s1_rfind = s1.rfind - for x in _RANGE_1000: - s1_rfind(s2) - -@bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000) -def rfind_test_no_match_two_character_bis(STR): - s1 = STR("AB" * 1000) - s2 = STR("CA") - s1_rfind = s1.rfind - for x in _RANGE_1000: - s1_rfind(s2) - -@bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000) -def rfind_test_slow_match_two_characters(STR): - s1 = STR("C" + "AB" * 300) - s2 = STR("CA") - s1_rfind = s1.rfind - for x in _RANGE_1000: - s1_rfind(s2) - -@bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000) -def rfind_test_slow_match_two_characters_bis(STR): - s1 = STR("BC" + "AB" * 300) - s2 = STR("BC") - s1_rfind = s1.rfind - for x in _RANGE_1000: - s1_rfind(s2) - -@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)', - "late match, 100 characters", 100) -def rfind_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = e+m + (d+m)*500 - s2 = e+m - s1_rfind = s1.rfind - for x in _RANGE_100: - s1_rfind(s2) - -@bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")', - "late match, 100 characters", 100) -def rfind_test_slow_match_100_characters_bis(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = m+e + (d+m)*500 - s2 = m+e - s1_rfind = s1.rfind - for x in _RANGE_100: - s1_rfind(s2) - - -#### Now with index. -# Skip the ones which fail because that would include exception overhead. - -@bench('("A"*1000).index("A")', "early match, single character", 1000) -def index_test_quick_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("A") - s1_index = s1.index - for x in _RANGE_1000: - s1_index(s2) - -@bench('("AB"*1000).index("AB")', "early match, two characters", 1000) -def index_test_quick_match_two_characters(STR): - s1 = STR("AB" * 1000) - s2 = STR("AB") - s1_index = s1.index - for x in _RANGE_1000: - s1_index(s2) - -@bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000) -def index_test_slow_match_two_characters(STR): - s1 = STR("AB" * 300+"C") - s2 = STR("BC") - s1_index = s1.index - for x in _RANGE_1000: - s1_index(s2) - -@bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")', - "late match, 100 characters", 100) -def index_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = (m+d)*500 + m+e - s2 = m+e - s1_index = s1.index - for x in _RANGE_100: - s1_index(s2) - - -#### Same for rindex - -@bench('("A"*1000).rindex("A")', "early match, single character", 1000) -def rindex_test_quick_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("A") - s1_rindex = s1.rindex - for x in _RANGE_1000: - s1_rindex(s2) - -@bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000) -def rindex_test_quick_match_two_characters(STR): - s1 = STR("AB" * 1000) - s2 = STR("AB") - s1_rindex = s1.rindex - for x in _RANGE_1000: - s1_rindex(s2) - -@bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000) -def rindex_test_slow_match_two_characters(STR): - s1 = STR("C" + "AB" * 300) - s2 = STR("CA") - s1_rindex = s1.rindex - for x in _RANGE_1000: - s1_rindex(s2) - -@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)', - "late match, 100 characters", 100) -def rindex_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = e + m + (d+m)*500 - s2 = e + m - s1_rindex = s1.rindex - for x in _RANGE_100: - s1_rindex(s2) - - -#### Same for partition - -@bench('("A"*1000).partition("A")', "early match, single character", 1000) -def partition_test_quick_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("A") - s1_partition = s1.partition - for x in _RANGE_1000: - s1_partition(s2) - -@bench('("A"*1000).partition("B")', "no match, single character", 1000) -def partition_test_no_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("B") - s1_partition = s1.partition - for x in _RANGE_1000: - s1_partition(s2) - - -@bench('("AB"*1000).partition("AB")', "early match, two characters", 1000) -def partition_test_quick_match_two_characters(STR): - s1 = STR("AB" * 1000) - s2 = STR("AB") - s1_partition = s1.partition - for x in _RANGE_1000: - s1_partition(s2) - -@bench('("AB"*1000).partition("BC")', "no match, two characters", 1000) -def partition_test_no_match_two_character(STR): - s1 = STR("AB" * 1000) - s2 = STR("BC") - s1_partition = s1.partition - for x in _RANGE_1000: - s1_partition(s2) - -@bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000) -def partition_test_slow_match_two_characters(STR): - s1 = STR("AB" * 300+"C") - s2 = STR("BC") - s1_partition = s1.partition - for x in _RANGE_1000: - s1_partition(s2) - -@bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")', - "late match, 100 characters", 100) -def partition_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = (m+d)*500 + m+e - s2 = m+e - s1_partition = s1.partition - for x in _RANGE_100: - s1_partition(s2) - - -#### Same for rpartition - -@bench('("A"*1000).rpartition("A")', "early match, single character", 1000) -def rpartition_test_quick_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("A") - s1_rpartition = s1.rpartition - for x in _RANGE_1000: - s1_rpartition(s2) - -@bench('("A"*1000).rpartition("B")', "no match, single character", 1000) -def rpartition_test_no_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("B") - s1_rpartition = s1.rpartition - for x in _RANGE_1000: - s1_rpartition(s2) - - -@bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000) -def rpartition_test_quick_match_two_characters(STR): - s1 = STR("AB" * 1000) - s2 = STR("AB") - s1_rpartition = s1.rpartition - for x in _RANGE_1000: - s1_rpartition(s2) - -@bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000) -def rpartition_test_no_match_two_character(STR): - s1 = STR("AB" * 1000) - s2 = STR("BC") - s1_rpartition = s1.rpartition - for x in _RANGE_1000: - s1_rpartition(s2) - -@bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000) -def rpartition_test_slow_match_two_characters(STR): - s1 = STR("C" + "AB" * 300) - s2 = STR("CA") - s1_rpartition = s1.rpartition - for x in _RANGE_1000: - s1_rpartition(s2) - -@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)', - "late match, 100 characters", 100) -def rpartition_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = e + m + (d+m)*500 - s2 = e + m - s1_rpartition = s1.rpartition - for x in _RANGE_100: - s1_rpartition(s2) - - -#### Same for split(s, 1) - -@bench('("A"*1000).split("A", 1)', "early match, single character", 1000) -def split_test_quick_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("A") - s1_split = s1.split - for x in _RANGE_1000: - s1_split(s2, 1) - -@bench('("A"*1000).split("B", 1)', "no match, single character", 1000) -def split_test_no_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("B") - s1_split = s1.split - for x in _RANGE_1000: - s1_split(s2, 1) - - -@bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000) -def split_test_quick_match_two_characters(STR): - s1 = STR("AB" * 1000) - s2 = STR("AB") - s1_split = s1.split - for x in _RANGE_1000: - s1_split(s2, 1) - -@bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000) -def split_test_no_match_two_character(STR): - s1 = STR("AB" * 1000) - s2 = STR("BC") - s1_split = s1.split - for x in _RANGE_1000: - s1_split(s2, 1) - -@bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000) -def split_test_slow_match_two_characters(STR): - s1 = STR("AB" * 300+"C") - s2 = STR("BC") - s1_split = s1.split - for x in _RANGE_1000: - s1_split(s2, 1) - -@bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)', - "late match, 100 characters", 100) -def split_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = (m+d)*500 + m+e - s2 = m+e - s1_split = s1.split - for x in _RANGE_100: - s1_split(s2, 1) - - -#### Same for rsplit(s, 1) - -@bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000) -def rsplit_test_quick_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("A") - s1_rsplit = s1.rsplit - for x in _RANGE_1000: - s1_rsplit(s2, 1) - -@bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000) -def rsplit_test_no_match_single_character(STR): - s1 = STR("A" * 1000) - s2 = STR("B") - s1_rsplit = s1.rsplit - for x in _RANGE_1000: - s1_rsplit(s2, 1) - - -@bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000) -def rsplit_test_quick_match_two_characters(STR): - s1 = STR("AB" * 1000) - s2 = STR("AB") - s1_rsplit = s1.rsplit - for x in _RANGE_1000: - s1_rsplit(s2, 1) - -@bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000) -def rsplit_test_no_match_two_character(STR): - s1 = STR("AB" * 1000) - s2 = STR("BC") - s1_rsplit = s1.rsplit - for x in _RANGE_1000: - s1_rsplit(s2, 1) - -@bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000) -def rsplit_test_slow_match_two_characters(STR): - s1 = STR("C" + "AB" * 300) - s2 = STR("CA") - s1_rsplit = s1.rsplit - for x in _RANGE_1000: - s1_rsplit(s2, 1) - -@bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)', - "late match, 100 characters", 100) -def rsplit_test_slow_match_100_characters(STR): - m = STR("ABC"*33) - d = STR("D") - e = STR("E") - s1 = e + m + (d+m)*500 - s2 = e + m - s1_rsplit = s1.rsplit - for x in _RANGE_100: - s1_rsplit(s2, 1) - - -#### Benchmark the operator-based methods - -@bench('"A"*10', "repeat 1 character 10 times", 1000) -def repeat_single_10_times(STR): - s = STR("A") - for x in _RANGE_1000: - s * 10 - -@bench('"A"*1000', "repeat 1 character 1000 times", 1000) -def repeat_single_1000_times(STR): - s = STR("A") - for x in _RANGE_1000: - s * 1000 - -@bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000) -def repeat_5_10_times(STR): - s = STR("ABCDE") - for x in _RANGE_1000: - s * 10 - -@bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000) -def repeat_5_1000_times(STR): - s = STR("ABCDE") - for x in _RANGE_1000: - s * 1000 - -# + for concat - -@bench('"Andrew"+"Dalke"', "concat two strings", 1000) -def concat_two_strings(STR): - s1 = STR("Andrew") - s2 = STR("Dalke") - for x in _RANGE_1000: - s1+s2 - -@bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15", - 1000) -def concat_many_strings(STR): - s1=STR('TIXSGYNREDCVBHJ') - s2=STR('PUMTLXBZVDO') - s3=STR('FVZNJ') - s4=STR('OGDXUW') - s5=STR('WEIMRNCOYVGHKB') - s6=STR('FCQTNMXPUZH') - s7=STR('TICZJYRLBNVUEAK') - s8=STR('REYB') - s9=STR('PWUOQ') - s10=STR('EQHCMKBS') - s11=STR('AEVDFOH') - s12=STR('IFHVD') - s13=STR('JGTCNLXWOHQ') - s14=STR('ITSKEPYLROZAWXF') - s15=STR('THEK') - s16=STR('GHPZFBUYCKMNJIT') - s17=STR('JMUZ') - s18=STR('WLZQMTB') - s19=STR('KPADCBW') - s20=STR('TNJHZQAGBU') - for x in _RANGE_1000: - (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+ - s11+s12+s13+s14+s15+s16+s17+s18+s19+s20) - - -#### Benchmark join - -def get_bytes_yielding_seq(STR, arg): - if STR is BYTES and sys.version_info >= (3,): - raise UnsupportedType - return STR(arg) - -@bench('"A".join("")', - "join empty string, with 1 character sep", 100) -def join_empty_single(STR): - sep = STR("A") - s2 = get_bytes_yielding_seq(STR, "") - sep_join = sep.join - for x in _RANGE_100: - sep_join(s2) - -@bench('"ABCDE".join("")', - "join empty string, with 5 character sep", 100) -def join_empty_5(STR): - sep = STR("ABCDE") - s2 = get_bytes_yielding_seq(STR, "") - sep_join = sep.join - for x in _RANGE_100: - sep_join(s2) - -@bench('"A".join("ABC..Z")', - "join string with 26 characters, with 1 character sep", 1000) -def join_alphabet_single(STR): - sep = STR("A") - s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") - sep_join = sep.join - for x in _RANGE_1000: - sep_join(s2) - -@bench('"ABCDE".join("ABC..Z")', - "join string with 26 characters, with 5 character sep", 1000) -def join_alphabet_5(STR): - sep = STR("ABCDE") - s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") - sep_join = sep.join - for x in _RANGE_1000: - sep_join(s2) - -@bench('"A".join(list("ABC..Z"))', - "join list of 26 characters, with 1 character sep", 1000) -def join_alphabet_list_single(STR): - sep = STR("A") - s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] - sep_join = sep.join - for x in _RANGE_1000: - sep_join(s2) - -@bench('"ABCDE".join(list("ABC..Z"))', - "join list of 26 characters, with 5 character sep", 1000) -def join_alphabet_list_five(STR): - sep = STR("ABCDE") - s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] - sep_join = sep.join - for x in _RANGE_1000: - sep_join(s2) - -@bench('"A".join(["Bob"]*100))', - "join list of 100 words, with 1 character sep", 1000) -def join_100_words_single(STR): - sep = STR("A") - s2 = [STR("Bob")]*100 - sep_join = sep.join - for x in _RANGE_1000: - sep_join(s2) - -@bench('"ABCDE".join(["Bob"]*100))', - "join list of 100 words, with 5 character sep", 1000) -def join_100_words_5(STR): - sep = STR("ABCDE") - s2 = [STR("Bob")]*100 - sep_join = sep.join - for x in _RANGE_1000: - sep_join(s2) - -#### split tests - -@bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000) -def whitespace_split(STR): - s = STR("Here are some words. "*2) - s_split = s.split - for x in _RANGE_1000: - s_split() - -@bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000) -def whitespace_rsplit(STR): - s = STR("Here are some words. "*2) - s_rsplit = s.rsplit - for x in _RANGE_1000: - s_rsplit() - -@bench('("Here are some words. "*2).split(None, 1)', - "split 1 whitespace", 1000) -def whitespace_split_1(STR): - s = STR("Here are some words. "*2) - s_split = s.split - N = None - for x in _RANGE_1000: - s_split(N, 1) - -@bench('("Here are some words. "*2).rsplit(None, 1)', - "split 1 whitespace", 1000) -def whitespace_rsplit_1(STR): - s = STR("Here are some words. "*2) - s_rsplit = s.rsplit - N = None - for x in _RANGE_1000: - s_rsplit(N, 1) - -@bench('("Here are some words. "*2).partition(" ")', - "split 1 whitespace", 1000) -def whitespace_partition(STR): - sep = STR(" ") - s = STR("Here are some words. "*2) - s_partition = s.partition - for x in _RANGE_1000: - s_partition(sep) - -@bench('("Here are some words. "*2).rpartition(" ")', - "split 1 whitespace", 1000) -def whitespace_rpartition(STR): - sep = STR(" ") - s = STR("Here are some words. "*2) - s_rpartition = s.rpartition - for x in _RANGE_1000: - s_rpartition(sep) - -human_text = """\ -Python is a dynamic object-oriented programming language that can be -used for many kinds of software development. It offers strong support -for integration with other languages and tools, comes with extensive -standard libraries, and can be learned in a few days. Many Python -programmers report substantial productivity gains and feel the language -encourages the development of higher quality, more maintainable code. - -Python runs on Windows, Linux/Unix, Mac OS X, Amiga, Palm -Handhelds, and Nokia mobile phones. Python has also been ported to the -Java and .NET virtual machines. - -Python is distributed under an OSI-approved open source license that -makes it free to use, even for commercial products. -"""*25 -human_text_bytes = bytes_from_str(human_text) -human_text_unicode = unicode_from_str(human_text) -def _get_human_text(STR): - if STR is UNICODE: - return human_text_unicode - if STR is BYTES: - return human_text_bytes - raise AssertionError - -@bench('human_text.split()', "split whitespace (huge)", 10) -def whitespace_split_huge(STR): - s = _get_human_text(STR) - s_split = s.split - for x in _RANGE_10: - s_split() - -@bench('human_text.rsplit()', "split whitespace (huge)", 10) -def whitespace_rsplit_huge(STR): - s = _get_human_text(STR) - s_rsplit = s.rsplit - for x in _RANGE_10: - s_rsplit() - - - -@bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000) -def newlines_split(STR): - s = STR("this\nis\na\ntest\n") - s_split = s.split - nl = STR("\n") - for x in _RANGE_1000: - s_split(nl) - - -@bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000) -def newlines_rsplit(STR): - s = STR("this\nis\na\ntest\n") - s_rsplit = s.rsplit - nl = STR("\n") - for x in _RANGE_1000: - s_rsplit(nl) - -@bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000) -def newlines_splitlines(STR): - s = STR("this\nis\na\ntest\n") - s_splitlines = s.splitlines - for x in _RANGE_1000: - s_splitlines() - -## split text with 2000 newlines - -def _make_2000_lines(): - import random - r = random.Random(100) - chars = list(map(chr, range(32, 128))) - i = 0 - while i < len(chars): - chars[i] = " " - i += r.randrange(9) - s = "".join(chars) - s = s*4 - words = [] - for i in range(2000): - start = r.randrange(96) - n = r.randint(5, 65) - words.append(s[start:start+n]) - return "\n".join(words)+"\n" - -_text_with_2000_lines = _make_2000_lines() -_text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines) -_text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines) -def _get_2000_lines(STR): - if STR is UNICODE: - return _text_with_2000_lines_unicode - if STR is BYTES: - return _text_with_2000_lines_bytes - raise AssertionError - - -@bench('"...text...".split("\\n")', "split 2000 newlines", 10) -def newlines_split_2000(STR): - s = _get_2000_lines(STR) - s_split = s.split - nl = STR("\n") - for x in _RANGE_10: - s_split(nl) - -@bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10) -def newlines_rsplit_2000(STR): - s = _get_2000_lines(STR) - s_rsplit = s.rsplit - nl = STR("\n") - for x in _RANGE_10: - s_rsplit(nl) - -@bench('"...text...".splitlines()', "split 2000 newlines", 10) -def newlines_splitlines_2000(STR): - s = _get_2000_lines(STR) - s_splitlines = s.splitlines - for x in _RANGE_10: - s_splitlines() - - -## split text on "--" characters -@bench( - '"this--is--a--test--of--the--emergency--broadcast--system".split("--")', - "split on multicharacter separator (small)", 1000) -def split_multichar_sep_small(STR): - s = STR("this--is--a--test--of--the--emergency--broadcast--system") - s_split = s.split - pat = STR("--") - for x in _RANGE_1000: - s_split(pat) -@bench( - '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")', - "split on multicharacter separator (small)", 1000) -def rsplit_multichar_sep_small(STR): - s = STR("this--is--a--test--of--the--emergency--broadcast--system") - s_rsplit = s.rsplit - pat = STR("--") - for x in _RANGE_1000: - s_rsplit(pat) - -## split dna text on "ACTAT" characters -@bench('dna.split("ACTAT")', - "split on multicharacter separator (dna)", 10) -def split_multichar_sep_dna(STR): - s = _get_dna(STR) - s_split = s.split - pat = STR("ACTAT") - for x in _RANGE_10: - s_split(pat) - -@bench('dna.rsplit("ACTAT")', - "split on multicharacter separator (dna)", 10) -def rsplit_multichar_sep_dna(STR): - s = _get_dna(STR) - s_rsplit = s.rsplit - pat = STR("ACTAT") - for x in _RANGE_10: - s_rsplit(pat) - - - -## split with limits - -GFF3_example = "\t".join([ - "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".", - "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"]) - -@bench('GFF3_example.split("\\t")', "tab split", 1000) -def tab_split_no_limit(STR): - sep = STR("\t") - s = STR(GFF3_example) - s_split = s.split - for x in _RANGE_1000: - s_split(sep) - -@bench('GFF3_example.split("\\t", 8)', "tab split", 1000) -def tab_split_limit(STR): - sep = STR("\t") - s = STR(GFF3_example) - s_split = s.split - for x in _RANGE_1000: - s_split(sep, 8) - -@bench('GFF3_example.rsplit("\\t")', "tab split", 1000) -def tab_rsplit_no_limit(STR): - sep = STR("\t") - s = STR(GFF3_example) - s_rsplit = s.rsplit - for x in _RANGE_1000: - s_rsplit(sep) - -@bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000) -def tab_rsplit_limit(STR): - sep = STR("\t") - s = STR(GFF3_example) - s_rsplit = s.rsplit - for x in _RANGE_1000: - s_rsplit(sep, 8) - -#### Count characters - -@bench('...text.with.2000.newlines.count("\\n")', - "count newlines", 10) -def count_newlines(STR): - s = _get_2000_lines(STR) - s_count = s.count - nl = STR("\n") - for x in _RANGE_10: - s_count(nl) - -# Orchid sequences concatenated, from Biopython -_dna = """ -CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT -AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG -AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT -TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC -AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG -TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT -CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT -TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT -GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC -TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG -GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA -ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC -CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA -ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA -ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA -TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG -CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG -GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA -ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG -ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC -ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA -GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA -TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG -TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT -TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG -GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG -GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT -AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC -GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG -TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT -CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA -TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC -TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC -AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT -GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT -GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA -CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG -GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA -TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG -ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT -GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA -AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC -AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA -ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC -GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC -GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC -AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA -GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG -ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC -GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC -""" -_dna = "".join(_dna.splitlines()) -_dna = _dna * 25 -_dna_bytes = bytes_from_str(_dna) -_dna_unicode = unicode_from_str(_dna) - -def _get_dna(STR): - if STR is UNICODE: - return _dna_unicode - if STR is BYTES: - return _dna_bytes - raise AssertionError - -@bench('dna.count("AACT")', "count AACT substrings in DNA example", 10) -def count_aact(STR): - seq = _get_dna(STR) - seq_count = seq.count - needle = STR("AACT") - for x in _RANGE_10: - seq_count(needle) - -##### startswith and endswith - -@bench('"Andrew".startswith("A")', 'startswith single character', 1000) -def startswith_single(STR): - s1 = STR("Andrew") - s2 = STR("A") - s1_startswith = s1.startswith - for x in _RANGE_1000: - s1_startswith(s2) - -@bench('"Andrew".startswith("Andrew")', 'startswith multiple characters', - 1000) -def startswith_multiple(STR): - s1 = STR("Andrew") - s2 = STR("Andrew") - s1_startswith = s1.startswith - for x in _RANGE_1000: - s1_startswith(s2) - -@bench('"Andrew".startswith("Anders")', - 'startswith multiple characters - not!', 1000) -def startswith_multiple_not(STR): - s1 = STR("Andrew") - s2 = STR("Anders") - s1_startswith = s1.startswith - for x in _RANGE_1000: - s1_startswith(s2) - - -# endswith - -@bench('"Andrew".endswith("w")', 'endswith single character', 1000) -def endswith_single(STR): - s1 = STR("Andrew") - s2 = STR("w") - s1_endswith = s1.endswith - for x in _RANGE_1000: - s1_endswith(s2) - -@bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000) -def endswith_multiple(STR): - s1 = STR("Andrew") - s2 = STR("Andrew") - s1_endswith = s1.endswith - for x in _RANGE_1000: - s1_endswith(s2) - -@bench('"Andrew".endswith("Anders")', - 'endswith multiple characters - not!', 1000) -def endswith_multiple_not(STR): - s1 = STR("Andrew") - s2 = STR("Anders") - s1_endswith = s1.endswith - for x in _RANGE_1000: - s1_endswith(s2) - -#### Strip - -@bench('"Hello!\\n".strip()', 'strip terminal newline', 1000) -def terminal_newline_strip_right(STR): - s = STR("Hello!\n") - s_strip = s.strip - for x in _RANGE_1000: - s_strip() - -@bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000) -def terminal_newline_rstrip(STR): - s = STR("Hello!\n") - s_rstrip = s.rstrip - for x in _RANGE_1000: - s_rstrip() - -@bench('"\\nHello!".strip()', 'strip terminal newline', 1000) -def terminal_newline_strip_left(STR): - s = STR("\nHello!") - s_strip = s.strip - for x in _RANGE_1000: - s_strip() - -@bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000) -def terminal_newline_strip_both(STR): - s = STR("\nHello!\n") - s_strip = s.strip - for x in _RANGE_1000: - s_strip() - -@bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000) -def terminal_newline_lstrip(STR): - s = STR("\nHello!") - s_lstrip = s.lstrip - for x in _RANGE_1000: - s_lstrip() - -@bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s', - 'strip terminal newline', 1000) -def terminal_newline_if_else(STR): - s = STR("Hello!\n") - NL = STR("\n") - for x in _RANGE_1000: - s[:-1] if (s[-1] == NL) else s - - -# Strip multiple spaces or tabs - -@bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000) -def terminal_space_strip(STR): - s = STR("Hello\t \t!") - s_strip = s.strip - for x in _RANGE_1000: - s_strip() - -@bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000) -def terminal_space_rstrip(STR): - s = STR("Hello!\t \t") - s_rstrip = s.rstrip - for x in _RANGE_1000: - s_rstrip() - -@bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000) -def terminal_space_lstrip(STR): - s = STR("\t \tHello!") - s_lstrip = s.lstrip - for x in _RANGE_1000: - s_lstrip() - - -#### replace -@bench('"This is a test".replace(" ", "\\t")', 'replace single character', - 1000) -def replace_single_character(STR): - s = STR("This is a test!") - from_str = STR(" ") - to_str = STR("\t") - s_replace = s.replace - for x in _RANGE_1000: - s_replace(from_str, to_str) - -@uses_re -@bench('re.sub(" ", "\\t", "This is a test"', 'replace single character', - 1000) -def replace_single_character_re(STR): - s = STR("This is a test!") - pat = re.compile(STR(" ")) - to_str = STR("\t") - pat_sub = pat.sub - for x in _RANGE_1000: - pat_sub(to_str, s) - -@bench('"...text.with.2000.lines...replace("\\n", " ")', - 'replace single character, big string', 10) -def replace_single_character_big(STR): - s = _get_2000_lines(STR) - from_str = STR("\n") - to_str = STR(" ") - s_replace = s.replace - for x in _RANGE_10: - s_replace(from_str, to_str) - -@uses_re -@bench('re.sub("\\n", " ", "...text.with.2000.lines...")', - 'replace single character, big string', 10) -def replace_single_character_big_re(STR): - s = _get_2000_lines(STR) - pat = re.compile(STR("\n")) - to_str = STR(" ") - pat_sub = pat.sub - for x in _RANGE_10: - pat_sub(to_str, s) - - -@bench('dna.replace("ATC", "ATT")', - 'replace multiple characters, dna', 10) -def replace_multiple_characters_dna(STR): - seq = _get_dna(STR) - from_str = STR("ATC") - to_str = STR("ATT") - seq_replace = seq.replace - for x in _RANGE_10: - seq_replace(from_str, to_str) - -# This increases the character count -@bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")', - 'replace and expand multiple characters, big string', 10) -def replace_multiple_character_big(STR): - s = _get_2000_lines(STR) - from_str = STR("\n") - to_str = STR("\r\n") - s_replace = s.replace - for x in _RANGE_10: - s_replace(from_str, to_str) - - -# This decreases the character count -@bench('"When shall we three meet again?".replace("ee", "")', - 'replace/remove multiple characters', 1000) -def replace_multiple_character_remove(STR): - s = STR("When shall we three meet again?") - from_str = STR("ee") - to_str = STR("") - s_replace = s.replace - for x in _RANGE_1000: - s_replace(from_str, to_str) - - -big_s = "A" + ("Z"*128*1024) -big_s_bytes = bytes_from_str(big_s) -big_s_unicode = unicode_from_str(big_s) -def _get_big_s(STR): - if STR is UNICODE: return big_s_unicode - if STR is BYTES: return big_s_bytes - raise AssertionError - -# The older replace implementation counted all matches in -# the string even when it only needed to make one replacement. -@bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)', - 'quick replace single character match', 10) -def quick_replace_single_match(STR): - s = _get_big_s(STR) - from_str = STR("A") - to_str = STR("BB") - s_replace = s.replace - for x in _RANGE_10: - s_replace(from_str, to_str, 1) - -@bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)', - 'quick replace multiple character match', 10) -def quick_replace_multiple_match(STR): - s = _get_big_s(STR) - from_str = STR("AZZ") - to_str = STR("BBZZ") - s_replace = s.replace - for x in _RANGE_10: - s_replace(from_str, to_str, 1) - - -#### - -# CCP does a lot of this, for internationalisation of ingame messages. -_format = "The %(thing)s is %(place)s the %(location)s." -_format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", } -_format_bytes = bytes_from_str(_format) -_format_unicode = unicode_from_str(_format) -_format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items()) -_format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items()) - -def _get_format(STR): - if STR is UNICODE: - return _format_unicode - if STR is BYTES: - if sys.version_info >= (3,): - raise UnsupportedType - return _format_bytes - raise AssertionError - -def _get_format_dict(STR): - if STR is UNICODE: - return _format_dict_unicode - if STR is BYTES: - if sys.version_info >= (3,): - raise UnsupportedType - return _format_dict_bytes - raise AssertionError - -# Formatting. -@bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}', - 'formatting a string type with a dict', 1000) -def format_with_dict(STR): - s = _get_format(STR) - d = _get_format_dict(STR) - for x in _RANGE_1000: - s % d - - -#### Upper- and lower- case conversion - -@bench('("Where in the world is Carmen San Deigo?"*10).lower()', - "case conversion -- rare", 1000) -def lower_conversion_rare(STR): - s = STR("Where in the world is Carmen San Deigo?"*10) - s_lower = s.lower - for x in _RANGE_1000: - s_lower() - -@bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()', - "case conversion -- dense", 1000) -def lower_conversion_dense(STR): - s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10) - s_lower = s.lower - for x in _RANGE_1000: - s_lower() - - -@bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()', - "case conversion -- rare", 1000) -def upper_conversion_rare(STR): - s = STR("Where in the world is Carmen San Deigo?"*10) - s_upper = s.upper - for x in _RANGE_1000: - s_upper() - -@bench('("where in the world is carmen san deigo?"*10).upper()', - "case conversion -- dense", 1000) -def upper_conversion_dense(STR): - s = STR("where in the world is carmen san deigo?"*10) - s_upper = s.upper - for x in _RANGE_1000: - s_upper() - - -# end of benchmarks - -################# - -class BenchTimer(timeit.Timer): - def best(self, repeat=1): - for i in range(1, 10): - number = 10**i - x = self.timeit(number) - if x > 0.02: - break - times = [x] - for i in range(1, repeat): - times.append(self.timeit(number)) - return min(times) / number - -def main(): - (options, test_names) = parser.parse_args() - if options.bytes_only and options.unicode_only: - raise SystemExit("Only one of --8-bit and --unicode are allowed") - - bench_functions = [] - for (k,v) in globals().items(): - if hasattr(v, "is_bench"): - if test_names: - for name in test_names: - if name in v.group: - break - else: - # Not selected, ignore - continue - if options.skip_re and hasattr(v, "uses_re"): - continue - - bench_functions.append( (v.group, k, v) ) - bench_functions.sort() - - p("bytes\tunicode") - p("(in ms)\t(in ms)\t%\tcomment") - - bytes_total = uni_total = 0.0 - - for title, group in itertools.groupby(bench_functions, - operator.itemgetter(0)): - # Flush buffer before each group - sys.stdout.flush() - p("="*10, title) - for (_, k, v) in group: - if hasattr(v, "is_bench"): - bytes_time = 0.0 - bytes_time_s = " - " - if not options.unicode_only: - try: - bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,), - "import __main__").best(REPEAT) - bytes_time_s = "%.2f" % (1000 * bytes_time) - bytes_total += bytes_time - except UnsupportedType: - bytes_time_s = "N/A" - uni_time = 0.0 - uni_time_s = " - " - if not options.bytes_only: - try: - uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,), - "import __main__").best(REPEAT) - uni_time_s = "%.2f" % (1000 * uni_time) - uni_total += uni_time - except UnsupportedType: - uni_time_s = "N/A" - try: - average = bytes_time/uni_time - except (TypeError, ZeroDivisionError): - average = 0.0 - p("%s\t%s\t%.1f\t%s (*%d)" % ( - bytes_time_s, uni_time_s, 100.*average, - v.comment, v.repeat_count)) - - if bytes_total == uni_total == 0.0: - p("That was zippy!") - else: - try: - ratio = bytes_total/uni_total - except ZeroDivisionError: - ratio = 0.0 - p("%.2f\t%.2f\t%.1f\t%s" % ( - 1000*bytes_total, 1000*uni_total, 100.*ratio, - "TOTAL")) - -if __name__ == "__main__": - main() |